View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16002_high_10 (Length: 202)

Name: NF16002_high_10
Description: NF16002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16002_high_10
NF16002_high_10
[»] chr5 (1 HSPs)
chr5 (11-185)||(37942049-37942222)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 37942222 - 37942049
Alignment:
Q  11 gtagcataggacctctctgtgtgtggaatgtgattaatggaagcccctttgaaatatgttggatccccatcttatctaaacctatattcagttggttgca 110  Q
    |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||    
T  37942222 gtagcataagacctctctgtgtgtggaatgtgattaatggaagaccctttgaaatatggtggatccccat-ttatctaaacctatattcagttggttgca 37942124  T
Q  111 catggaagattcttgttgatttgattaacgataatcacatgtttagtggtactactcccacactggtgagatatg 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  37942123 catggaagattcttgttgatttgattaacgataatcacatgtttagtggtactactcccacactgatgagatatg 37942049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University