View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15999_low_45 (Length: 208)

Name: NF15999_low_45
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15999_low_45
NF15999_low_45
[»] chr3 (2 HSPs)
chr3 (13-189)||(3640914-3641090)
chr3 (15-78)||(3639782-3639850)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 189
Target Start/End: Original strand, 3640914 - 3641090
Alignment:
Q  13 agatgaaccttactagtaattagtaactgattatactaatcttactataatgtaatatctctgttacattgtatgaagtctgaacttactcctctctccc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3640914 agatgaaccttactagtaattagtaactgattatactaatcttactataatgtaatatctctgttacattgtatgaagtctgaacttactcctctctccc 3641013  T
Q  113 ttttcaannnnnnnncttcatgttgtgcagcatggaggtggacgggcgttcaaaactcttcaatggttagttcggag 189  Q
    |||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3641014 ttttcaattttttttcttcatgttgtgcagcatggaggtggacgggcgttcaaaactcttcaatggttagttcggag 3641090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 3639782 - 3639850
Alignment:
Q  15 atgaaccttactagtaattagtaactgattatacta-----atcttactataatgtaatatctctgtta 78  Q
    ||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||    
T  3639782 atgaaccttactagtaattagtaactgattatactaatcttatcttactataatgtaatatctctgtta 3639850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University