View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15999_low_15 (Length: 390)

Name: NF15999_low_15
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15999_low_15
NF15999_low_15
[»] chr8 (3 HSPs)
chr8 (17-226)||(33116098-33116294)
chr8 (320-381)||(33115806-33115867)
chr8 (260-309)||(33115984-33116033)


Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 33116294 - 33116098
Alignment:
Q  17 aaggaggatgatagaatcaaatttattttcacaagcatcctctagaaaatagggctgccctagatatttagactcacacattgcacacttgcagttgcac 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||      |||||    
T  33116294 aaggaggatgatagaatcaaatttattttcacaagcatcctctaaaaaatagggctgccctagatatttagactcacacattgcacact------tgcac 33116201  T
Q  117 gtatgtaatgagtggaagtggtgaatgtcaaagattgctgttggttgcaacttcgaaagaagtgccatgcatgggataaagtcaagtcaatatgatttgt 216  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||| |||||||||||    |||||||||||||||||||||||||||||||    
T  33116200 gtatgtaatgagtggaagtggtgaatgtcaaagat---tgttggttgcaacttagaaagaagtgc----catgggataaagtcaagtcaatatgatttgt 33116108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 320 - 381
Target Start/End: Complemental strand, 33115867 - 33115806
Alignment:
Q  320 cacagaaaattatgataaatcagaagtactaatttagtccatatttagtattgcagtataat 381  Q
    ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  33115867 cacagaaaactatgataaatcagaagtattaatttagtccatatttagtattgcagtataat 33115806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 260 - 309
Target Start/End: Complemental strand, 33116033 - 33115984
Alignment:
Q  260 gataacttttggaataactattgataagaaaatcaaaacaatagagagaa 309  Q
    ||||||||||||||||| |||| ||||||||||||||||||| |||||||    
T  33116033 gataacttttggaataaatattaataagaaaatcaaaacaatggagagaa 33115984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University