View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15995_low_1 (Length: 572)

Name: NF15995_low_1
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15995_low_1
NF15995_low_1
[»] chr2 (3 HSPs)
chr2 (445-553)||(37212819-37212927)
chr2 (13-131)||(37213242-37213358)
chr2 (236-274)||(37213096-37213134)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 9e-50; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 445 - 553
Target Start/End: Complemental strand, 37212927 - 37212819
Alignment:
Q  445 tccatcaccatgaagcagagaacaagacctactttaccaaacaacttccacaaattcctgaaaccaggaaccctagctcgcctccgcgactcaaagataa 544  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  37212927 tccatcaccatgaagcagagaacaagacctactttaccaaaccacttccacaaattcctcaaaccaggaaccctagctcgcctccgcgactcaaagataa 37212828  T
Q  545 ccgccagat 553  Q
    |||||||||    
T  37212827 ccgccagat 37212819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 37213358 - 37213242
Alignment:
Q  13 aatatatgtattgaatcagtatattcaaaattttgcttcagttttaattgaactcttgttgatgaatgatatatgatagattttttagattaattattca 112  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||    
T  37213358 aatatctgtattgaatcagtatatttaaaattttgcttcaattttaattgaactcctgttgatgaatg--atatgatagattttttagattaattattca 37213261  T
Q  113 ttgaattagataccgagtt 131  Q
    |||||||||||| ||||||    
T  37213260 ttgaattagatatcgagtt 37213242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 37213134 - 37213096
Alignment:
Q  236 atcaagatcccgcctctatcccctagttttgttgttttt 274  Q
    |||||||||||||||||||||||||||||||||||||||    
T  37213134 atcaagatcccgcctctatcccctagttttgttgttttt 37213096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University