View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15993_low_14 (Length: 230)

Name: NF15993_low_14
Description: NF15993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15993_low_14
NF15993_low_14
[»] chr2 (1 HSPs)
chr2 (4-213)||(6127568-6127777)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 6127568 - 6127777
Alignment:
Q  4 acttggtcgattagaaaaccaacaaaattatagcgatgacgagtaatggatgagaaggagagaactagaagaaagac-----gggaacaaattgagtggt 98  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||      |||||||     ||||||||||||||||||    
T  6127568 acttggtcgattagaaaaccaacaaaattatagcgatgaggagtaatggatgagaaggagagaa------gaaagacctagggggaacaaattgagtggt 6127661  T
Q  99 ttaaaaataaaagtaccaccttttgacggaagaaataatttagagacttattcagaatgggaaacaaaaattgaacgaatttttgttgtaacacct-tat 197  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||    
T  6127662 ttaaaaataaaagtaccaccttttgacggaagaaataattcagagacttatttagaatgggaaacaaaaatggaacgaatttttgttgtaacacctgtat 6127761  T
Q  198 taacgttaaaaagatg 213  Q
    ||||||||||||||||    
T  6127762 taacgttaaaaagatg 6127777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University