View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15986_low_54 (Length: 222)

Name: NF15986_low_54
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15986_low_54
NF15986_low_54
[»] scaffold0140 (1 HSPs)
scaffold0140 (61-204)||(34769-34912)


Alignment Details
Target: scaffold0140 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 61 - 204
Target Start/End: Original strand, 34769 - 34912
Alignment:
Q  61 tttggattgaaggccagtttttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggacg 160  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  34769 tttggattgaaggcgagtgtttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggagg 34868  T
Q  161 agttagttcctttcaagtactttggtctctcgataaaggtgaat 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  34869 agttagttcctttcaagtactttggtctctcgataaaggtgaat 34912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University