View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15984_low_38 (Length: 236)

Name: NF15984_low_38
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15984_low_38
NF15984_low_38
[»] chr2 (1 HSPs)
chr2 (11-129)||(8923956-8924075)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 129
Target Start/End: Original strand, 8923956 - 8924075
Alignment:
Q  11 cgaagaatatcaactatcaaagacaaagattatgacattata-ttttttacttcattatcctattataannnnnnnatgaccgaaagttttaagtgagtt 109  Q
    |||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||       ||||||||||||||||||||||||    
T  8923956 cgaacaatatcaactatcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagtt 8924055  T
Q  110 gcaaggccgcaaatagtaag 129  Q
    ||||||||||||||||||||    
T  8924056 gcaaggccgcaaatagtaag 8924075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University