View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_low_94 (Length: 209)

Name: NF15978_low_94
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_low_94
NF15978_low_94
[»] chr2 (1 HSPs)
chr2 (14-191)||(9370780-9370957)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 9370780 - 9370957
Alignment:
Q  14 caaagggagaatatctttataaccgttttaagccatttgactttggagttgacagatttggctaactttaattgattttggaccttgttggtagatggtt 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9370780 caaaaggagaatatctttataaccgttttaagccatttgactttggagttgacagatttggctaactttaattgattttggaccttgttggtagatggtt 9370879  T
Q  114 ccacttattatacagtatggcaagcaactagatgtggatcacattcatagatagtgaaatgacgagtaatcaatttag 191  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||    
T  9370880 ccacttattatagagtatggcaagcaactagatgtggatcacattcatagatagtgaaatgaccagcaatcaatttag 9370957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University