View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_low_74 (Length: 243)

Name: NF15978_low_74
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_low_74
NF15978_low_74
[»] chr7 (2 HSPs)
chr7 (170-234)||(32164610-32164674)
chr7 (36-89)||(32164700-32164753)
[»] chr5 (1 HSPs)
chr5 (1-37)||(14729588-14729624)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 32164674 - 32164610
Alignment:
Q  170 tttcatccagtcgccatgaggacgacatcatccaatttcaccgataaaattgatatcatctgtga 234  Q
    |||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||    
T  32164674 tttcatccagtcgccatgaggacgacgtcatccaatttcaccaataaaattgatgtcatctgtga 32164610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 36 - 89
Target Start/End: Complemental strand, 32164753 - 32164700
Alignment:
Q  36 ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcatgtgat 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  32164753 ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcacgtgat 32164700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 14729588 - 14729624
Alignment:
Q  1 tcttttagtctttaaatctacgattcttgtctatgtt 37  Q
    |||||||||||||||||||| ||| ||||||||||||    
T  14729588 tcttttagtctttaaatctatgatccttgtctatgtt 14729624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University