View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_low_29 (Length: 372)

Name: NF15978_low_29
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_low_29
NF15978_low_29
[»] chr3 (2 HSPs)
chr3 (106-241)||(42717476-42717611)
chr3 (317-364)||(42717367-42717414)


Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 106 - 241
Target Start/End: Complemental strand, 42717611 - 42717476
Alignment:
Q  106 aatgcaattcacactactatctttccccttcgttcttttcttttttcattcacacttgctagatctgacttcaattaactcatttcgtactattattctt 205  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||    
T  42717611 aatgctattcacactactatctttccccttcgttcttttcttttttcattcacacttgctagatctgacttcaatcaactcattttgtactattattctt 42717512  T
Q  206 ttttctttcttcgtctctatattattgatattactt 241  Q
    |||||||||||||||||  ||||||| |||||||||    
T  42717511 ttttctttcttcgtctcgttattattaatattactt 42717476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 317 - 364
Target Start/End: Complemental strand, 42717414 - 42717367
Alignment:
Q  317 ggatgatgggatatgatctagttgcatatttggatggatttgatgatg 364  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
T  42717414 ggatgatggaatatgatctagttgcatatttggatggatttgatgatg 42717367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University