View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_high_94 (Length: 204)

Name: NF15978_high_94
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_high_94
NF15978_high_94
[»] chr7 (1 HSPs)
chr7 (16-186)||(31519698-31519868)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 31519868 - 31519698
Alignment:
Q  16 aaaatcatttcctcgccaatgcttcaccatctcagacaccttcgtcagcgtggctatgcaccacccatgcagcaggttcgggagctcttttagctcccgt 115  Q
    ||||||||||||||||||||||| |||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||      
T  31519868 aaaatcatttcctcgccaatgctccaccgtctcagacacgttcatcagcgtggctatgcaccacccatgcagcaggttcgggagtttttttagctcccac 31519769  T
Q  116 ggctgtgtttgatggcagtgttcgtcgccatagttctaaatttggtggattcaacagtggtgattgtagtg 186  Q
     |||| ||||||||| |||| || ||||||||||||||||||||||||||||||| |||||||||||||||    
T  31519768 agctgcgtttgatggtagtgctcctcgccatagttctaaatttggtggattcaacggtggtgattgtagtg 31519698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University