View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_high_55 (Length: 273)

Name: NF15978_high_55
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_high_55
NF15978_high_55
[»] chr1 (3 HSPs)
chr1 (1-255)||(24144477-24144739)
chr1 (136-237)||(24126380-24126481)
chr1 (92-131)||(18315497-18315536)
[»] chr4 (4 HSPs)
chr4 (28-131)||(40991355-40991458)
chr4 (80-131)||(29538078-29538129)
chr4 (70-131)||(52163305-52163366)
chr4 (28-131)||(10308728-10308830)
[»] chr3 (1 HSPs)
chr3 (92-131)||(46210548-46210587)
[»] chr2 (2 HSPs)
chr2 (29-124)||(5194003-5194098)
chr2 (84-131)||(41266855-41266902)
[»] chr7 (2 HSPs)
chr7 (149-201)||(43532976-43533028)
chr7 (29-73)||(29685492-29685536)
[»] chr8 (1 HSPs)
chr8 (36-116)||(6269626-6269706)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 24144739 - 24144477
Alignment:
Q  1 atttgttgtaatgcttatattagggtctgggtcaatagtcatgtggtctgaccagcgacccattgt--------ttcgaccgatgacctagtgacctaat 92  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||         | ||||| |||||||||||||| |||    
T  24144739 atttgttgtaatgcttatattagtgtctgggtcaatagtcatgcggtctgaccagtgacccattgagccattggtccgaccaatgacctagtgacccaat 24144640  T
Q  93 gccttgaccgggtcgatcaccggttcgggttttaaaacaccagttattatggaaccatttacctctccaagccaagctcatagatgacatctaatgctct 192  Q
    |||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24144639 gccttgaccgggtcgatcactggtccgggttttaaaacactagttattatggaaccatttacctctccaagccaagctcatagatgacatctaatgctct 24144540  T
Q  193 tttttccttttgttccttagtgaatgtcttcggtagtcttaaccgtgctgtgtatgtcaatgt 255  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  24144539 tttttccttttgttccttagttaatgtcttcggtagtcttaaccgtgctgtgtatgtcaatgt 24144477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 136 - 237
Target Start/End: Complemental strand, 24126481 - 24126380
Alignment:
Q  136 ttattatggaaccatttacctctccaagccaagctcatagatgacatctaatgctcttttttccttttgttccttagtgaatgtcttcggtagtcttaac 235  Q
    ||||| || |||||||||||| || || ||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||| || || ||||||    
T  24126481 ttattgtgcaaccatttacctttctaatccaagctcatagatgacatctaaagctctttgttccttttgttccttagttaatgtctttggaagccttaac 24126382  T
Q  236 cg 237  Q
    ||    
T  24126381 cg 24126380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 92 - 131
Target Start/End: Original strand, 18315497 - 18315536
Alignment:
Q  92 tgccttgaccgggtcgatcaccggttcgggttttaaaaca 131  Q
    |||||||||||| |||||||||||| ||||||||||||||    
T  18315497 tgccttgaccggatcgatcaccggtccgggttttaaaaca 18315536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 131
Target Start/End: Original strand, 40991355 - 40991458
Alignment:
Q  28 tgggtcaatagtcatgtggtctgaccagcgacccattgtttcgaccgatgacctagtgacctaatgccttgaccgggtcgatcaccggttcgggttttaa 127  Q
    |||||||||||||||| |||| |||||| ||||||||| | |||||  ||| | ||||| | | |||||||||||||||||  |||||| ||||||||||    
T  40991355 tgggtcaatagtcatgcggtccgaccagtgacccattggtccgaccactgatccagtgatccagtgccttgaccgggtcgactaccggtccgggttttaa 40991454  T
Q  128 aaca 131  Q
    ||||    
T  40991455 aaca 40991458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 80 - 131
Target Start/End: Complemental strand, 29538129 - 29538078
Alignment:
Q  80 ctagtgacctaatgccttgaccgggtcgatcaccggttcgggttttaaaaca 131  Q
    ||||||||| | |||||||| |||||||||||||||| ||||||||||||||    
T  29538129 ctagtgacccagtgccttgatcgggtcgatcaccggtccgggttttaaaaca 29538078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 70 - 131
Target Start/End: Original strand, 52163305 - 52163366
Alignment:
Q  70 gaccgatgacctagtgacctaatgccttgaccgggtcgatcaccggttcgggttttaaaaca 131  Q
    |||| |||| ||||| ||| | ||||||||||| ||||||||||||| ||||||||||||||    
T  52163305 gaccaatgaactagtaacccagtgccttgaccgtgtcgatcaccggtccgggttttaaaaca 52163366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 131
Target Start/End: Original strand, 10308728 - 10308830
Alignment:
Q  28 tgggtcaatagtcatgtggtctgaccagcgacccattgtttcgaccgatgacctagtgacctaatgccttgaccgggtcgatcaccggttcgggttttaa 127  Q
    |||||||||||||||| |||| |||||| || |||||| |  |||| | |||| ||||||||| |||||||||| | ||||  |||| | ||||||||||    
T  10308728 tgggtcaatagtcatgcggtccgaccagtgatccattggtctgacc-acgacccagtgacctagtgccttgaccagatcgactaccgatccgggttttaa 10308826  T
Q  128 aaca 131  Q
    ||||    
T  10308827 aaca 10308830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 131
Target Start/End: Original strand, 46210548 - 46210587
Alignment:
Q  92 tgccttgaccgggtcgatcaccggttcgggttttaaaaca 131  Q
    ||||||||||||||||||||||||| ||||||||||||||    
T  46210548 tgccttgaccgggtcgatcaccggtccgggttttaaaaca 46210587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 124
Target Start/End: Original strand, 5194003 - 5194098
Alignment:
Q  29 gggtcaatagtcatgtggtctgaccagcgacccattgtttcgaccgatgacctagtgacctaatgccttgaccgggtcgatcaccggttcgggttt 124  Q
    ||||||||| ||||| ||| ||||||  ||||||||| |||||||  ||||| ||| ||| | | ||||||| ||||||||||||||||| |||||    
T  5194003 gggtcaataatcatgcggtttgaccaatgacccattggttcgaccactgacccagtaacccagtaccttgactgggtcgatcaccggttcaggttt 5194098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 131
Target Start/End: Original strand, 41266855 - 41266902
Alignment:
Q  84 tgacctaatgccttgaccgggtcgatcaccggttcgggttttaaaaca 131  Q
    ||||| |||||||||||||||||||  |||||| ||||||||||||||    
T  41266855 tgacccaatgccttgaccgggtcgactaccggtccgggttttaaaaca 41266902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 43532976 - 43533028
Alignment:
Q  149 atttacctctccaagccaagctcatagatgacatctaatgctcttttttcctt 201  Q
    |||||||||||||| || ||||||||||| |||||||| ||||||| ||||||    
T  43532976 atttacctctccaatcctagctcatagataacatctaaagctctttgttcctt 43533028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 29685536 - 29685492
Alignment:
Q  29 gggtcaatagtcatgtggtctgaccagcgacccattgtttcgacc 73  Q
    ||||||||||||||| |||| |||||| ||||||||| |||||||    
T  29685536 gggtcaatagtcatgcggtccgaccagtgacccattgattcgacc 29685492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 6269706 - 6269626
Alignment:
Q  36 tagtcatgtggtctgaccagcgacccattgtttcgaccgatgacctagtgacctaatgccttgaccgggtcgatcaccggt 116  Q
    |||||||| ||||||||||| |||||| || |||| |  |||| | || |||| ||||| |||||||| ||||||||||||    
T  6269706 tagtcatgcggtctgaccagtgacccactgattcggcaaatgatccagcgacccaatgctttgaccggatcgatcaccggt 6269626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University