View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_high_54 (Length: 273)

Name: NF15978_high_54
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_high_54
NF15978_high_54
[»] chr4 (1 HSPs)
chr4 (19-261)||(33947934-33948176)


Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 33948176 - 33947934
Alignment:
Q  19 tgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcggttggaatgtgaaggggtgattatatagagaagggaag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33948176 tgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcggttggaatgtgaaggggtgattatatagagaagggaag 33948077  T
Q  119 tggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggactagactggtttttagaaggagcagcctttactagacta 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33948076 tggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggactagactggtttttagaaggagcagcctttactagacta 33947977  T
Q  219 ccaattgttttccttgctatcattaattatagtatattcttgg 261  Q
    ||||||||||||||||||||||||||||||||||| |||||||    
T  33947976 ccaattgttttccttgctatcattaattatagtattttcttgg 33947934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University