View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15974_low_12 (Length: 354)

Name: NF15974_low_12
Description: NF15974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15974_low_12
NF15974_low_12
[»] chr1 (4 HSPs)
chr1 (15-300)||(35939694-35939987)
chr1 (15-224)||(35953388-35953597)
chr1 (38-157)||(35947917-35948036)
chr1 (96-157)||(35929119-35929180)
[»] chr6 (2 HSPs)
chr6 (109-157)||(31175100-31175148)
chr6 (114-154)||(31206440-31206480)
[»] chr7 (1 HSPs)
chr7 (117-154)||(47583367-47583404)


Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 300
Target Start/End: Complemental strand, 35939987 - 35939694
Alignment:
Q  15 aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaaccct 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  35939987 aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccagccct 35939888  T
Q  115 tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaacaggcagagattcttgcggcaaatgcttgagtgtatgtccactttt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  35939887 tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaacaggcagagattcttgcggcaaatgcttgactgtatgtccactttt 35939788  T
Q  215 ctcattttagnnnnnnntattttaaaatacaaaccattttatactc--------atttataaggttaattaagttgttaccactaaactcacat 300  Q
    ||||||||||       |||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||    
T  35939787 ctcattttagaaaaaaatattttaaaatacaaaccattttatactcatttataaatttataaggttaattaagttgttaccactaaactcacat 35939694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 35953597 - 35953388
Alignment:
Q  15 aacgtaagggcaacatacaataattacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaaccct 114  Q
    ||||| |||||||||||| |   ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||| ||||    
T  35953597 aacgttagggcaacataccacctttacaaccctcagaatattaactggaactacaacactgccagtgtttactgtgctacatgggatgccaaccagccct 35953498  T
Q  115 tgtcatggcgtagcaaatatggttggactgccttttgtggaccagctgggccaaca-ggcagagattcttgcggcaaatgcttgagtgtatgtccacttt 213  Q
    |||||||||||   || ||||| ||||||||||||||||||||  | |||||  || |||||||| ||||||||||| |||||||| ||||| |||||||    
T  35953497 tgtcatggcgtcaaaagtatggctggactgccttttgtggacc-ccagggccctcatggcagagactcttgcggcaagtgcttgagggtatgaccacttt 35953399  T
Q  214 tctcattttag 224  Q
     ||||||||||    
T  35953398 actcattttag 35953388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 35948036 - 35947917
Alignment:
Q  38 ttacaaccctcagaatattaactgggactacaacactgccagtgtatactgtgctacctgggatgccaaccaacccttgtcatggcgtagcaaatatggt 137  Q
    ||||||||||||||||||||| ||||| |||||||  ||||||||||||||||||||||||||||| ||||| ||||||  ||||||||  || ||||||    
T  35948036 ttacaaccctcagaatattaattgggattacaacagagccagtgtatactgtgctacctgggatgcaaaccagcccttggaatggcgtaaaaagtatggt 35947937  T
Q  138 tggactgccttttgtggacc 157  Q
    ||||||||||||||||||||    
T  35947936 tggactgccttttgtggacc 35947917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 96 - 157
Target Start/End: Complemental strand, 35929180 - 35929119
Alignment:
Q  96 tgggatgccaaccaacccttgtcatggcgtagcaaatatggttggactgccttttgtggacc 157  Q
    ||||||||  |||| |||||||||||||||||||||||||||||||||||||| ||||||||    
T  35929180 tgggatgcagaccagcccttgtcatggcgtagcaaatatggttggactgccttctgtggacc 35929119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 31175148 - 31175100
Alignment:
Q  109 aacccttgtcatggcgtagcaaatatggttggactgccttttgtggacc 157  Q
    |||| ||||||||||| ||||||||||||||| ||||||||||||||||    
T  31175148 aaccattgtcatggcgaagcaaatatggttgggctgccttttgtggacc 31175100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 31206480 - 31206440
Alignment:
Q  114 ttgtcatggcgtagcaaatatggttggactgccttttgtgg 154  Q
    ||||||||||| ||||||||||||||| |||||||||||||    
T  31206480 ttgtcatggcgaagcaaatatggttgggctgccttttgtgg 31206440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 47583367 - 47583404
Alignment:
Q  117 tcatggcgtagcaaatatggttggactgccttttgtgg 154  Q
    |||||||||||||| |||||||||||||| ||||||||    
T  47583367 tcatggcgtagcaagtatggttggactgctttttgtgg 47583404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University