View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15973_high_13 (Length: 224)

Name: NF15973_high_13
Description: NF15973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15973_high_13
NF15973_high_13
[»] chr2 (1 HSPs)
chr2 (13-208)||(45196054-45196259)
[»] chr1 (1 HSPs)
chr1 (98-156)||(1495396-1495454)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 45196054 - 45196259
Alignment:
Q  13 agataattctctgtagttgttagattcattcaacacttgatctgtttccggaggattcaagccatgtagtgtgcgttgagctgcggcccattgtgcttct 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45196054 agataattctctgtagttgttagattcattcaacacttgatctgtttccggaggattcaagccatgtagtgtgcgttgagctgcggcccattgtgcttct 45196153  T
Q  113 ctctctccttttccataatccttctttgaggtgaaggcagtctg----------catagtacnnnnnnncatggtcagatagaaacacaaattagaaatt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||          ||||||||       |||||||||||||||||||||||||||||||    
T  45196154 ctctctccttttccataatccttctttgaggtgaaggcagtctgcattacattacatagtacaaaaaaacatggtcagatagaaacacaaattagaaatt 45196253  T
Q  203 aatcat 208  Q
    ||||||    
T  45196254 aatcat 45196259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 98 - 156
Target Start/End: Original strand, 1495396 - 1495454
Alignment:
Q  98 gcccattgtgcttctctctctccttttccataatccttctttgaggtgaaggcagtctg 156  Q
    |||||||||||||| |||||| |||||||||| || |||||||  ||||||||||||||    
T  1495396 gcccattgtgcttccctctcttcttttccatagtctttctttgtagtgaaggcagtctg 1495454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University