View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1596_low_105 (Length: 246)

Name: NF1596_low_105
Description: NF1596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1596_low_105
NF1596_low_105
[»] chr2 (1 HSPs)
chr2 (1-243)||(25968779-25969021)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25968779 - 25969021
Alignment:
Q  1 tcggcgtcatcgcacaaggtgagactagggaagctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggcgtaaacggggcaga 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  25968779 tcggcgtcatcgcacaaggtgagaccagggaagctatcccgccagacttcttcgcacggattatgaacgatgtcgtgttgtggggtgtaaacggggcaga 25968878  T
Q  101 gatacttttggtgtcggtaaacctcctcttagagtaattaaactggcgaaaatttcttgtgaatcggttgatcttcaatgaatctttccgattttcaaat 200  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  25968879 gatacttttggtgtcggtaaacctcctcttagagtagttaaactggcgaaaatttcttgtgaatcggttggtcttcaatgaatctttccgattttcaaat 25968978  T
Q  201 gtgtctgcattgttgttgcgtctcttgggtatgtctctgctcc 243  Q
    || ||||||||||||||||||||||||||||||| ||||||||    
T  25968979 gtatctgcattgttgttgcgtctcttgggtatgtttctgctcc 25969021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University