View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15967_low_8 (Length: 399)

Name: NF15967_low_8
Description: NF15967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15967_low_8
NF15967_low_8
[»] chr6 (1 HSPs)
chr6 (231-399)||(11524003-11524171)


Alignment Details
Target: chr6 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 231 - 399
Target Start/End: Complemental strand, 11524171 - 11524003
Alignment:
Q  231 tcaaaatctaaaccataaaaacttaccaaagatcttttagcaatatcgaactcaagaatggctgatacaactctagaacagacctggcaatgggggtgca 330  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||    
T  11524171 tcaaaatctaaaccataaaaacttaccaaagatcttttagcaatatcgaactcaagaatagctgatgcaactctagaacagacctggcaatgggggtgca 11524072  T
Q  331 aacgactttacaaagatgggcctcnnnnnnntcattggggtctcaaattgtttattaaaggcatatctt 399  Q
    ||||||||||||||| ||||||||       |||||||||||||||||||||||||| |||||||||||    
T  11524071 aacgactttacaaagttgggcctcaaaaaaatcattggggtctcaaattgtttattacaggcatatctt 11524003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University