View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15963_low_5 (Length: 239)

Name: NF15963_low_5
Description: NF15963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15963_low_5
NF15963_low_5
[»] chr8 (1 HSPs)
chr8 (52-239)||(5906024-5906211)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 52 - 239
Target Start/End: Complemental strand, 5906211 - 5906024
Alignment:
Q  52 tcattgcttaaactttgtgatagtgatactatttgaggcttattatcctaaatagtatccaaactgccgaagaaacatgattatcttggtcataaagtac 151  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5906211 tcattgcttaaactttgcgatagtgatactatttgaggcttattatcctaaatagtatccaaactgccgaagaaacatgattatcttggtcataaagtac 5906112  T
Q  152 aggatcttcattgagctccatttacataagtaatgagaactgtccaaaattcacgagtcacggaaagacataattacgaatcagcctc 239  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||    
T  5906111 tggatcttcattgagctccatttacataagtaatgagaactgtccaaaattcaagagtcacagaaagacataattacgaatcagcctc 5906024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University