View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15962_low_68 (Length: 337)

Name: NF15962_low_68
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15962_low_68
NF15962_low_68
[»] scaffold0768 (2 HSPs)
scaffold0768 (18-187)||(215-384)
scaffold0768 (195-337)||(460-602)
[»] chr6 (1 HSPs)
chr6 (17-93)||(6845795-6845873)


Alignment Details
Target: scaffold0768 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: scaffold0768
Description:

Target: scaffold0768; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 215 - 384
Alignment:
Q  18 aagttatatctaaaggaggaagatttattattgagggaaaaaaggtggtaagatgttgctttgaaaaaggttatacaatgtgtggctatgtgtctatgga 117  Q
    ||||||||| |||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  215 aagttatatataaaggaggaagatatattattgagagaaaaagggtggtaagatgttgctttgaaaaaggttatacaatgtgtggctatgtgtctatgga 314  T
Q  118 gtggatgaaaacttattttataggtataatacaatcaattctcagcacttgcagcaaaaggacaaacata 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  315 gtggatgaaaacttattttataggtataatacaatcaattctcagcacttgcaacaaaaggacaaacata 384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0768; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 195 - 337
Target Start/End: Original strand, 460 - 602
Alignment:
Q  195 tgaactttctttatttcgattttattttttgtgttgcaatagatacaatgaaaatgaataaaacaaaagtattatannnnnnnnnataaagcacataaaa 294  Q
    ||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||         |||||||||| ||||    
T  460 tgaactttctttatttcgaattttttttgtgtgttgcaatagatacaatgaaaatgaatgaaacaaaagtattataattttttttataaagcacacaaaa 559  T
Q  295 cgatgtttttgtcacatttaaacaaattttgtcattggatttc 337  Q
    | ||||||||||||||||| |||||||||||||||||||||||    
T  560 caatgtttttgtcacattttaacaaattttgtcattggatttc 602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 6845873 - 6845795
Alignment:
Q  17 aaagttatatctaaaggaggaagatttattattgag-ggaaaaaaggtggtaagatgttgcttt-gaaaaaggttatac 93  Q
    |||| ||||| ||||||||||||||||||||||||| | |||||| |||||||| ||||| ||| ||| ||||||||||    
T  6845873 aaagctatatataaaggaggaagatttattattgagagaaaaaaatgtggtaaggtgttggtttggaagaaggttatac 6845795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University