View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15962_low_122 (Length: 249)

Name: NF15962_low_122
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15962_low_122
NF15962_low_122
[»] chr5 (2 HSPs)
chr5 (26-133)||(35809508-35809615)
chr5 (198-239)||(35809671-35809712)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 26 - 133
Target Start/End: Original strand, 35809508 - 35809615
Alignment:
Q  26 tattacatattatctactcacgaaattctcatattgacagtgggattcgaacttagatccttatgagatatgagttgaatccttaccaacattcatcgga 125  Q
    |||||||||||||||||| |||||||||||||||||||| ||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  35809508 tattacatattatctactaacgaaattctcatattgacaatggaatttgaacttaaatccttatgagatatgagttgaatccttaccaacattcatcgga 35809607  T
Q  126 ttttagta 133  Q
    ||||||||    
T  35809608 ttttagta 35809615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 239
Target Start/End: Original strand, 35809671 - 35809712
Alignment:
Q  198 gtcaagcatttcacatttatgagtcatatcatatgcattcat 239  Q
    |||||||||||||||||||||||||||||||||| |||||||    
T  35809671 gtcaagcatttcacatttatgagtcatatcatatacattcat 35809712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University