View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15962_low_108 (Length: 262)

Name: NF15962_low_108
Description: NF15962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15962_low_108
NF15962_low_108
[»] chr2 (1 HSPs)
chr2 (17-249)||(17594335-17594567)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 17594567 - 17594335
Alignment:
Q  17 tataattgtttggcagccttggcactaggttccggcagccgtggtccctcggaggttttcaaaggtttttaggggaaaggccgccggaaccggctttcga 116  Q
    ||||||||||||||||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  17594567 tataattgtttggcagcctcggcactaggttccggcagccacggtccctcggaggttttcaaaggtttttaggggaaaggccaccggaaccggctttcga 17594468  T
Q  117 ataccaaacaacgaggaccaaatggttctcaaaaacaaagacacaaactatatatgaattattcaaatacgtaacattttttcttcttctacaaacaaag 216  Q
    |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  17594467 ataccaaacaacgaagaccaaatggctctcaaaaacaaagacacaaactatatatgaattattcaaatacgtaacattttttcttcttttacaaacaaag 17594368  T
Q  217 atattgttttcaagatttgagcacgcgaccttc 249  Q
    |||||||||||||||||||||||||||||||||    
T  17594367 atattgttttcaagatttgagcacgcgaccttc 17594335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University