View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15960_low_69 (Length: 222)

Name: NF15960_low_69
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15960_low_69
NF15960_low_69
[»] chr4 (1 HSPs)
chr4 (1-148)||(37641609-37641768)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 37641609 - 37641768
Alignment:
Q  1 tttagaaatcaagttcatttctgttggaagtagattttcaataacatttaaatttattgtttagaatact-----tcatttcaa-------tactgaaga 88  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||     ||| | |||       |||||||||    
T  37641609 tttagaaatcaagttcatttcagttggaagtagattttcaataacatttaaattcattgtttagaatactgaagatcactacaaggaataatactgaaga 37641708  T
Q  89 tcactactttttattgccaacaaaaggtcttcaattttggaaatcacaaaaattattttc 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37641709 tcactactttttattgccaacaaaaggtcttcaattttggaaatcacaaaaattattttc 37641768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University