View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15960_high_65 (Length: 237)

Name: NF15960_high_65
Description: NF15960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15960_high_65
NF15960_high_65
[»] chr8 (1 HSPs)
chr8 (13-219)||(2097043-2097249)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 2097043 - 2097249
Alignment:
Q  13 agcagagaaaccccccacagaacccccaacatcagagagaaccaatgatacagccaaaccaagacccctggagaaattaaatcatttcattgcagaaatt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2097043 agcagagaaaccccccacagaacccccaacatcagagagaaccaatgatacagccaaaccaagacccctggagaaattaaatcatttcattgcagaaatt 2097142  T
Q  113 ccaaatggtccacacaacaacgtgccaaact-aaagccagaccaaaccttggtttttcttagacctaaaactcgtnnnnnnnncctcaaaaactccttca 211  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||         ||||||||||||||||    
T  2097143 ccaaatggttcacacaacaacgtgccaaactaaaagccagaccaaactttggtttttcttagacctaagactcgtaaaaaaaa-ctcaaaaactccttca 2097241  T
Q  212 gataaaga 219  Q
    ||||||||    
T  2097242 gataaaga 2097249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University