View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15954_high_33 (Length: 241)

Name: NF15954_high_33
Description: NF15954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15954_high_33
NF15954_high_33
[»] chr5 (1 HSPs)
chr5 (85-158)||(39772354-39772427)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 85 - 158
Target Start/End: Original strand, 39772354 - 39772427
Alignment:
Q  85 gacttcggtacggagctgattctcgaggaggccaattgcgtggtggagtttttcggcggtggaggcaggggagc 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39772354 gacttcggtacggagctgattctcgaggaggccaattgcgtggtggagtttttcggcggtggaggcaggggagc 39772427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University