View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15950_low_15 (Length: 233)

Name: NF15950_low_15
Description: NF15950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15950_low_15
NF15950_low_15
[»] chr2 (3 HSPs)
chr2 (1-215)||(35161296-35161521)
chr2 (52-121)||(39839683-39839747)
chr2 (9-50)||(44798664-44798705)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 35161521 - 35161296
Alignment:
Q  1 agaaaattattattatgaatggaaaaacagtgtatgaaaataaataccttggacgagaggaaccaaaccgcaggacaggaca-----ggacggtgaagaa 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||    
T  35161521 agaaaattattattatgaatggaaaaacagtgtatgaaaataaataccttggacgagaggaaccaaaccgcaggacaggacaggacaggacggtgaagaa 35161422  T
Q  96 cgaacgagggagcgatagaaaacgaagnnnnnnntcaactctcaaaacgcgatgagcgaggattatctaatataatgatgatgagtata------tatgt 189  Q
    |||||||||||||||||||||||||||       |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||      |||||    
T  35161421 cgaacgagggagcgatagaaaacgaagaaaaaaatcaactctcaaaacgcgatgagggaggattatctaatataatgatgatgactatatatatctatgt 35161322  T
Q  190 tttaggttacttcattataccgtttt 215  Q
    ||||||||||||||||||||||||||    
T  35161321 tttaggttacttcattataccgtttt 35161296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 121
Target Start/End: Complemental strand, 39839747 - 39839683
Alignment:
Q  52 gacgagaggaaccaaaccgcaggacaggacaggacggtgaagaacgaacgagggagcgatagaaaacgaa 121  Q
    ||||||||||||||||||||||||||||||     ||||||||||||||||| |||||||||||||||||    
T  39839747 gacgagaggaaccaaaccgcaggacaggac-----ggtgaagaacgaacgagagagcgatagaaaacgaa 39839683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 44798664 - 44798705
Alignment:
Q  9 attattatgaatggaaaaacagtgtatgaaaataaatacctt 50  Q
    ||||||||||||||||||  |||| |||||||||||||||||    
T  44798664 attattatgaatggaaaacgagtgaatgaaaataaatacctt 44798705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University