View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15947_low_8 (Length: 215)

Name: NF15947_low_8
Description: NF15947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15947_low_8
NF15947_low_8
[»] chr7 (1 HSPs)
chr7 (18-189)||(42341785-42341956)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 42341785 - 42341956
Alignment:
Q  18 aatttgggattgatatgaatggtttacgaggaagaaagaggatggttgatggtcctgttgaaagggtggtggagagaaggcagaggaggatgatcaagaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42341785 aatttgggattgatatgaatggtttacgaggaagaaagaggatggttgatggtcctgttgaaagggtggtggagagaaggcagaggaggatgatcaagaa 42341884  T
Q  118 tagagagtcagcagcaagatctagagccagaaaacaggttcctgaaattttaaccaatcatattatacttaa 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42341885 tagagagtcagcagcaagatctagagccagaaaacaggttcctgaaattttaaccaatcatattatacttaa 42341956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University