View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15947_low_7 (Length: 219)

Name: NF15947_low_7
Description: NF15947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15947_low_7
NF15947_low_7
[»] chr8 (3 HSPs)
chr8 (39-137)||(40581834-40581932)
chr8 (134-210)||(40581995-40582071)
chr8 (1-40)||(40581775-40581814)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 39 - 137
Target Start/End: Original strand, 40581834 - 40581932
Alignment:
Q  39 tatgcatgtgctctagtgcaacatgtcatgtcttttatagcatctccatatatggcttccattatttcaaatcaaacttatgtaactgacgcgtatttt 137  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40581834 tatgcatgcgctctagtgcaacatgtcatgtcttttatagcatctccatatatggcttccattatttcaaatcaaacttatgtaactgacgcgtatttt 40581932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 40581995 - 40582071
Alignment:
Q  134 ttttttgtaagatgtaaaatctagggagaggagattaattgttcccaaaactaatcattattcatttactccctttg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40581995 ttttttgtaagatgtaaaatctagggagaggagattaattgttcccaaaactaatcattattcatttactccctttg 40582071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 40581775 - 40581814
Alignment:
Q  1 tttgcaattcaaatcactataaaagaaatattgttgggta 40  Q
    |||||||||||||||||||||||||||| ||| |||||||    
T  40581775 tttgcaattcaaatcactataaaagaaacatttttgggta 40581814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University