View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15945_high_31 (Length: 238)

Name: NF15945_high_31
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15945_high_31
NF15945_high_31
[»] chr1 (1 HSPs)
chr1 (1-197)||(46212444-46212642)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 46212642 - 46212444
Alignment:
Q  1 ataggacatgataatgttaaaaagctaaaggtctattgattgaggactcaactcaatttacttttcttcactttgagatagattccnnnnnnn--aacta 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||    
T  46212642 ataggacatgataatgttaaaaagctaaaggtctattgattgaggactcaactcaatttacttttcttcactttgagatagattcctttttttttaacta 46212543  T
Q  99 atatgaaaatttaagggagctgggttgcaaaagtttactagggtgaggacaatttccaaggttaaaaaaccactttcaaagatgattaagacctaaggg 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46212542 atatgaaaatttaagggagctgggttgcaaaagtttactagggtgaggacaatttccaaggttaaaaaaccactttcaaagatgattaagacctaaggg 46212444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University