View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15945_high_2 (Length: 486)

Name: NF15945_high_2
Description: NF15945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15945_high_2
NF15945_high_2
[»] chr1 (1 HSPs)
chr1 (17-120)||(52034611-52034714)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 52034611 - 52034714
Alignment:
Q  17 tgaacacggagactccacttattcacttaagagacaannnnnnnagccgaaaagccagttgacaacaataaaaaatgtcactcttttataaaacaaatgt 116  Q
    |||||||||| |||||||||||||||||||||||| |       ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  52034611 tgaacacggaaactccacttattcacttaagagacgatttttttagccgaaaagccagttgacaacaataaaaaacgtcactcttttataaaacaaatgt 52034710  T
Q  117 cact 120  Q
    ||||    
T  52034711 cact 52034714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University