View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_low_84 (Length: 350)

Name: NF15941_low_84
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_low_84
NF15941_low_84
[»] chr7 (1 HSPs)
chr7 (16-334)||(38684744-38685062)


Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 16 - 334
Target Start/End: Complemental strand, 38685062 - 38684744
Alignment:
Q  16 tttgtggagaggggagagagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38685062 tttgtggagaggggagagagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatg 38684963  T
Q  116 cggtggtgatgggattggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatga 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38684962 cggtggtgatgggattggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatga 38684863  T
Q  216 tgattgtggttctcctttggttttcatgcttgatgtcaatgagattttcaggtacttgctcattttgggtttggttaattaatttgttgctataagtatt 315  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38684862 tgattgtggttctcctttggttttcatgcttgatgtcaacgagattttcaggtacttgctcattttgggtttggttaattaatttgttgctataagtatt 38684763  T
Q  316 aagcacttctctgaatcat 334  Q
    |||||||||||||||||||    
T  38684762 aagcacttctctgaatcat 38684744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University