View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15940_high_31 (Length: 237)

Name: NF15940_high_31
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15940_high_31
NF15940_high_31
[»] chr8 (2 HSPs)
chr8 (80-156)||(26570431-26570507)
chr8 (152-216)||(26570553-26570617)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 80 - 156
Target Start/End: Original strand, 26570431 - 26570507
Alignment:
Q  80 gtgtgtcattatataaaacaaaagaagaagaacgagaatttatggaagcgggcctaaatgactttaaatggaagcaa 156  Q
    |||||||||||||| ||||||||| | || || |||||||||||||||||||||||||||||||||||| |||||||    
T  26570431 gtgtgtcattatatgaaacaaaagcaaaacaatgagaatttatggaagcgggcctaaatgactttaaatagaagcaa 26570507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 152 - 216
Target Start/End: Original strand, 26570553 - 26570617
Alignment:
Q  152 agcaagtaagcatgcatgggttaatctttatgcatgcatgatgttgtactagagttctactatat 216  Q
    |||||||| |||||||||||| | |||||||||||||||||| ||||||||||||||||||||||    
T  26570553 agcaagtaggcatgcatgggtcagtctttatgcatgcatgatattgtactagagttctactatat 26570617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University