View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1594-INSERTION-28 (Length: 500)

Name: NF1594-INSERTION-28
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1594-INSERTION-28
NF1594-INSERTION-28
[»] chr1 (2 HSPs)
chr1 (132-212)||(7348956-7349040)
chr1 (68-108)||(7349042-7349082)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 4e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 7349040 - 7348956
Alignment:
Q  132 ttccccatgacgaagaaggatgtgaag----actgttgaagatatgttagaggatgctgatttcaaaactcgtctaaaatggcat 212  Q
    |||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7349040 ttccccatgacgaagaaggatgtgaaggtacactgttgaagatatgttagaggatgctgatttcaaaactcgtctaaaatggcat 7348956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 7349082 - 7349042
Alignment:
Q  68 aaaatttaagtggctggggattaggccaacggatattatgg 108  Q
    |||||||||||||||||||||||||||||| ||||||||||    
T  7349082 aaaatttaagtggctggggattaggccaactgatattatgg 7349042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University