View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15934_low_25 (Length: 252)

Name: NF15934_low_25
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15934_low_25
NF15934_low_25
[»] chr6 (2 HSPs)
chr6 (128-209)||(3480747-3480829)
chr6 (210-252)||(3456718-3456760)


Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 3480829 - 3480747
Alignment:
Q  128 caactttgtgtatttctccctcttctgtattgtacgtataaggagtaagta-cattgtataaatgtggaaatgaaaaaaccat 209  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  3480829 caactttgagtatttctccctcttctgtattgtacgtataaggagtaagtagcattgtataaatgtggaaatgaaaaaaccat 3480747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 252
Target Start/End: Complemental strand, 3456760 - 3456718
Alignment:
Q  210 agagaaagtgtttttgacttttgttatttatgattaatattgt 252  Q
    ||||||||||||||||||||||| |||||||||||||||||||    
T  3456760 agagaaagtgtttttgacttttgctatttatgattaatattgt 3456718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University