View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_low_115 (Length: 228)

Name: NF15932_low_115
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_low_115
NF15932_low_115
[»] chr2 (1 HSPs)
chr2 (11-209)||(14392497-14392695)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 14392497 - 14392695
Alignment:
Q  11 tagataatacttaatagtatattgttgtaggaaggtatttgtcattgctctgaaaaagattcttccattgtgttgcagtaactttgtgaactagattagt 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  14392497 tagatattacttaatagtatattgttgtaggaaggtatttgtcattgctctgaaaaatattcttccattgtgttgcagtaactttgtgaactagattagt 14392596  T
Q  111 tgacacttgtatcatatttatcatgaatatcaataattataatactatactttgtcgaagatttttcaattgaaaaatgatagtatctcagtcagttgg 209  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14392597 tgacacttgtatcatatttatcatgaataataataattataatactatgctttgtcgaagatttttcaattgaaaaatgatagtatctcagtcagttgg 14392695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University