View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_high_96 (Length: 248)

Name: NF15932_high_96
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_high_96
NF15932_high_96
[»] chr3 (1 HSPs)
chr3 (53-232)||(40185520-40185690)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 53 - 232
Target Start/End: Complemental strand, 40185690 - 40185520
Alignment:
Q  53 gagggaggtgttagtattattgggctactaaaaattgttaacataacagcccaagttagcccaacccaagagcaagaaaaatgacaaaaatgtggctaaa 152  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
T  40185690 gagggaggtgttagtattattgggctactaaaaattgttaacataacagcccaagttagcccaaaccaagagcaagaaaaatgacaaaaatgtgggtaaa 40185591  T
Q  153 tgtctcagaagatactagaaagaaatatctacagcaaacgtcagggcacacgaaaacacaacattattttgataagaaat 232  Q
    |         |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  40185590 t---------gatactagaaagaaatatctgcagcaaacgtcagggcacacgaaaacacaacattattttgataagaaat 40185520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University