View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_high_89 (Length: 253)

Name: NF15932_high_89
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_high_89
NF15932_high_89
[»] chr8 (1 HSPs)
chr8 (206-252)||(44703704-44703750)


Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 44703750 - 44703704
Alignment:
Q  206 ttgtgcagtagatcatcaaattacagtgacatgtgtagaagaagaag 252  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||    
T  44703750 ttgtgtagtagatcatcaaattacagtgacatgtgtagaagaagaag 44703704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University