View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1592_low_11 (Length: 248)

Name: NF1592_low_11
Description: NF1592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1592_low_11
NF1592_low_11
[»] chr8 (1 HSPs)
chr8 (107-229)||(35425230-35425351)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 35425351 - 35425230
Alignment:
Q  107 gctaatacgtttagcaaacaatatctagttttttgtcatcaatatttcgttttaaataatagaaaatggttgtattnnnnnnnnctaaattagtgttaat 206  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||    
T  35425351 gctaatacttttagcaaacaatatctagttttttgtcatcaatatttcgttttaaataatagaaaatggttgtatt-aaaaaaactaaattagtgttaat 35425253  T
Q  207 ttaaagaccaaatgtgttgaaac 229  Q
    |||||| ||||||||||||||||    
T  35425252 ttaaaggccaaatgtgttgaaac 35425230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University