View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15927_low_77 (Length: 230)

Name: NF15927_low_77
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15927_low_77
NF15927_low_77
[»] chr7 (1 HSPs)
chr7 (1-187)||(44244656-44244842)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 44244656 - 44244842
Alignment:
Q  1 acgctttgttgaactggcatagatgagatcgccatcttgtgaggacaaataatactttgaacttctacataggagcaatatcagttgttaaagcttcaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44244656 acgctttgttgaactggcatagatgagatcgccatcttgtgaggacaaataatactttgaacttctacataggagcaatatcagttgttaaagcttcaaa 44244755  T
Q  101 cattagttcaacttggattatgagacacttttcttcgattgatttcatgatgtttatataacaagatgttcccagatcttgttataa 187  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44244756 cattagttcaacttggattatgaaacacttttcttcgattgatttcatgatgtttatataacaagatgttcccagatcttgttataa 44244842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University