View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15927_low_57 (Length: 283)

Name: NF15927_low_57
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15927_low_57
NF15927_low_57
[»] chr7 (2 HSPs)
chr7 (18-180)||(30692755-30692917)
chr7 (193-271)||(30692648-30692726)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 30692917 - 30692755
Alignment:
Q  18 attttgtatgtttagaaaatgtactgctgnnnnnnntaacaagagtgataatttcactttccaggtgataatctatgggatttgtatcaatgacactgaa 117  Q
    |||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30692917 attttgtatgtttagaaaatgtactgctgaaaaaaataacaagagtgataatttcactttccaggtgataatctatgggatttgtatcaatgacactgaa 30692818  T
Q  118 gcattatgtttttaaaagtgttttatctaaaaattaactgacatcaaaggttggaatttattg 180  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  30692817 gcattatgtttttaaaagtgttttatctaaaaattaactgatatcaaaggttggaatttattg 30692755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 193 - 271
Target Start/End: Complemental strand, 30692726 - 30692648
Alignment:
Q  193 ggcttcaagagtgattttgcaaaagaaaaggaaccttttgtttaatcacttcattagtcaacatactcgtgttatcctt 271  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  30692726 ggcttcaagagtgattttgcgaaagaaaaggaaccttttgtttaatcacttcattagtcaacatactagtgttatcctt 30692648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University