View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15927_low_39 (Length: 358)

Name: NF15927_low_39
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15927_low_39
NF15927_low_39
[»] chr5 (1 HSPs)
chr5 (12-48)||(42124033-42124069)
[»] chr6 (1 HSPs)
chr6 (115-180)||(32003352-32003416)


Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 42124033 - 42124069
Alignment:
Q  12 tgaacaagttttgagagaggttcaaaaatagccatga 48  Q
    |||||||||||||||||||||||||||||||| ||||    
T  42124033 tgaacaagttttgagagaggttcaaaaatagcaatga 42124069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 180
Target Start/End: Original strand, 32003352 - 32003416
Alignment:
Q  115 aaaccttttctaaatatcagtcgtaaagttttatttacaaaataaactaaatgatccttttcaaaa 180  Q
    ||||||||| |||| || ||||||||| ||||||| |||||||||| |||| | ||||||||||||    
T  32003352 aaacctttt-taaacataagtcgtaaacttttattaacaaaataaattaaaggttccttttcaaaa 32003416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University