View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15927_low_34 (Length: 385)

Name: NF15927_low_34
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15927_low_34
NF15927_low_34
[»] chr7 (4 HSPs)
chr7 (259-368)||(11453386-11453495)
chr7 (62-210)||(11453682-11453819)
chr7 (1-67)||(11454081-11454148)
chr7 (202-258)||(11453547-11453603)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 4e-48; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 259 - 368
Target Start/End: Complemental strand, 11453495 - 11453386
Alignment:
Q  259 gttggctccaattcaagccctatgcatcaccattaatttaccgcaaattccaaaagcttaatttatctctctaatcttgcaccacaatttccctaatttc 358  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||    
T  11453495 gttggctccaattcaaaccctatgcatcaccattaatttaccgcaaattccaaaaccttaatttatctctctaatcttgcaccacaatttccctaacttc 11453396  T
Q  359 tctcacaatc 368  Q
    ||||||||||    
T  11453395 tctcacaatc 11453386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 62 - 210
Target Start/End: Complemental strand, 11453819 - 11453682
Alignment:
Q  62 ttggaacctacatgaaataacgctgagatcatagtccatttaacacatgactatttaacatgttattagtttttatattagaattggcgttgcttt-ata 160  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||             ||||||| |||||||| |||||| || ||||||| |||    
T  11453819 ttggaacctacatgaaataacgttgagatcatagtccatttaacacatgt------------ttattagcttttatatgagaattagccttgcttttata 11453732  T
Q  161 attatcccattaatattaataatccattttatgaaagtgtctaccgatca 210  Q
    ||||||||| ||||||||||||||||||||||  |||| |||||||||||    
T  11453731 attatcccagtaatattaataatccattttatagaagtatctaccgatca 11453682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 11454148 - 11454081
Alignment:
Q  1 atggtttgtg-gttgaatcaaattgcatgattaatggtaattttttnnnnnnntgccttaagttggaa 67  Q
    |||||||||| |||||||||||||||||||||||||||||||||||       |||||||||||||||    
T  11454148 atggtttgtgtgttgaatcaaattgcatgattaatggtaattttttttaaaaatgccttaagttggaa 11454081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 258
Target Start/End: Complemental strand, 11453603 - 11453547
Alignment:
Q  202 taccgatcaaagtggtcaactaaataccttattgatttgcaattttttacaaaattg 258  Q
    ||||||||||||| |||||||  || ||||| | ||||||||| |||||||||||||    
T  11453603 taccgatcaaagtcgtcaactcgatgccttaataatttgcaatattttacaaaattg 11453547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University