View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15926_high_18 (Length: 285)

Name: NF15926_high_18
Description: NF15926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15926_high_18
NF15926_high_18
[»] chr1 (1 HSPs)
chr1 (81-223)||(35303065-35303205)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 81 - 223
Target Start/End: Complemental strand, 35303205 - 35303065
Alignment:
Q  81 gtggtcgaggttcgatcctcaaacctttgcatatattttatgcatcggccaactaagctaagctattcactctaattatacaacagaagcattttaaaat 180  Q
    |||| |||| ||||||||||||| ||||||||||  ||||||||| || ||||| |||||| ||||||||||||||||||||||||||||||||||||||    
T  35303205 gtggccgagtttcgatcctcaaatctttgcatat--tttatgcattggacaactgagctaaactattcactctaattatacaacagaagcattttaaaat 35303108  T
Q  181 actggaactgaaaaacaaagcattgcattaaccaaccatgaat 223  Q
    ||| |||||||||||||||||||||||||||||||||||||||    
T  35303107 acttgaactgaaaaacaaagcattgcattaaccaaccatgaat 35303065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University