View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15920_low_5 (Length: 231)

Name: NF15920_low_5
Description: NF15920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15920_low_5
NF15920_low_5
[»] chr3 (2 HSPs)
chr3 (86-212)||(27832751-27832877)
chr3 (17-60)||(27832883-27832926)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 86 - 212
Target Start/End: Complemental strand, 27832877 - 27832751
Alignment:
Q  86 gaagaagcctcggattcaagaattattgtatcgatcaaagaataatctctcagatggtacggacaatattcatacatcacaggcaaataattaataatga 185  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27832877 gaagaagcctcagattcaagaattattgtatcgatcaaagaataatctctcagatggtacggacaatattcatacatcacaggcaaataattaataatga 27832778  T
Q  186 tatgataaaaatataggtcgttaccag 212  Q
    |||||||||||||||||||||||||||    
T  27832777 tatgataaaaatataggtcgttaccag 27832751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 27832926 - 27832883
Alignment:
Q  17 cagagactctaaattgttgcctattctctcaatcaaaacagaaa 60  Q
    ||||||||||||||||||||||||| | ||||||||||||||||    
T  27832926 cagagactctaaattgttgcctattatttcaatcaaaacagaaa 27832883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University