View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15918_high_13 (Length: 204)

Name: NF15918_high_13
Description: NF15918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15918_high_13
NF15918_high_13
[»] chr7 (1 HSPs)
chr7 (68-189)||(33840528-33840649)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 33840649 - 33840528
Alignment:
Q  68 gctgttgttaaaaatggcattcataaccgccacagtatgcaaccaccttaaaaactgtcgtcggttccttctgccatcaattgttacaagtgttaacggt 167  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  33840649 gctgttgtttaaaattgcattcataaccgccacagtatgcaaccaccttaaaaactgtcgtcggtttcttctgccatcaattgttacaagtgttaacggt 33840550  T
Q  168 agtgaaatgcagtgcacaatac 189  Q
    ||||||||| ||||||||||||    
T  33840549 agtgaaatgtagtgcacaatac 33840528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University