View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15918_high_10 (Length: 242)

Name: NF15918_high_10
Description: NF15918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15918_high_10
NF15918_high_10
[»] chr3 (1 HSPs)
chr3 (1-224)||(51053883-51054106)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 51053883 - 51054106
Alignment:
Q  1 cggaagctttggtgtggagtatggtaatccatgaaccggcgaaactaactgcggccgcggtgattgaaaatgcggcatcaccggcggagactgtgacgtt 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51053883 cggaagctttggtgtggagtatggtaatcgatgaaccggcgaaactaactgcggccgcggtgattgaaaatgcggcatcaccggcggagactgtgacgtt 51053982  T
Q  101 ctctgctgctgccactgtggtggtgattgtttccacggccgtctcactggtgactgaaaatccaaatgcatttgcgccggaggtggcaaatacgacggtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51053983 ctctgctgctgccactgtggtggtgattgtttccacggccgtctcactggtgactgaaaatccaaatgcatttgcgccggaggtggcaaatacgacggtg 51054082  T
Q  201 tcggaggtcgtggaatggtttttg 224  Q
    ||||||||||||||||||||||||    
T  51054083 tcggaggtcgtggaatggtttttg 51054106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University