View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15916_low_59 (Length: 204)

Name: NF15916_low_59
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15916_low_59
NF15916_low_59
[»] chr7 (1 HSPs)
chr7 (25-186)||(46144511-46144669)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 25 - 186
Target Start/End: Original strand, 46144511 - 46144669
Alignment:
Q  25 cctcttcacctaatttaatccttctttgttttttctgcaacaaaaactcttcacccaatgccactaacttcattttcaaacactcactcaaatcatcatt 124  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46144511 cctcttcacctaatttaatcattctttgttttttctgcaacaaaaactcttcacccaatgccactaacttcattttcaaacactcactcaaatcatcatt 46144610  T
Q  125 atcactgctagctgctgctgctgctttctctctcttcctttccctttcttgtcctttgctac 186  Q
    ||||||||||   | |||| ||||||||||||||||||||||||||||||||||||||||||    
T  46144611 atcactgcta---gttgcttctgctttctctctcttcctttccctttcttgtcctttgctac 46144669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University