View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15911_low_16 (Length: 271)

Name: NF15911_low_16
Description: NF15911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15911_low_16
NF15911_low_16
[»] chr1 (1 HSPs)
chr1 (101-250)||(36463335-36463490)
[»] chr3 (1 HSPs)
chr3 (35-99)||(30764272-30764337)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 101 - 250
Target Start/End: Complemental strand, 36463490 - 36463335
Alignment:
Q  101 aatcatgagcaagtaggcagatgattgttttaaattagcaagataaatatagagcattgtgatatatgcgagagatga------tgattaagattgtttt 194  Q
    |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||      ||||||||||||||||    
T  36463490 aatcatgagcaagtaggcagatgattgttttaaattaggaagacaaatatagagcattgtgatatctgcgagagatgatgatgatgattaagattgtttt 36463391  T
Q  195 gttatggcaaggaggaattggtgtcatatgaatcttgaggcaacataatatgaagc 250  Q
    ||| ||||||||| |||||| ||||||||||||||| |||||| ||||||||||||    
T  36463390 gttgtggcaaggaagaattgttgtcatatgaatcttaaggcaatataatatgaagc 36463335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 35 - 99
Target Start/End: Original strand, 30764272 - 30764337
Alignment:
Q  35 taaaaacataagtgaataagctaaagagaagaatagaagtaccttagt-aaccacaatgtgattca 99  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| ||||||||    
T  30764272 taaaaacataagtgaatgagctaaagagaagaataaaagtaccttagtaaaccacaacgtgattca 30764337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University