View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15911_high_18 (Length: 214)

Name: NF15911_high_18
Description: NF15911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15911_high_18
NF15911_high_18
[»] chr4 (1 HSPs)
chr4 (13-200)||(27607502-27607689)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 27607689 - 27607502
Alignment:
Q  13 ccttcttgatcatgcaagtggcagcagctgtgacgataattgtactgtgcacgagttagagtgctaggaggatcgagtgaggaacaaaaatcagaggctt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  27607689 ccttcttgatcatgcaagtggcagcagctgtgacgataattgtactgtgcacgagttagaatgctaggaggatcgagtgaggaacaaaaatcagaggctt 27607590  T
Q  113 cacccatattcatttaggggtcagcttgcaatttctaaaaaattaatagattaccggtaacctaagctattttataagatagtaatat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27607589 cacccatattcatttaggggtcagcttgcaatttctaaaaaattaatagattaccggtaacctaagctattttataagatagtaatat 27607502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University