View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15908_high_43 (Length: 216)

Name: NF15908_high_43
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15908_high_43
NF15908_high_43
[»] chr2 (1 HSPs)
chr2 (22-208)||(425473-425659)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 425473 - 425659
Alignment:
Q  22 agtccataccaagatagtggtagtagcagatcacatccaacatctatccgcaaacattactgattttattgattcttgcattgcaatgttgtcaattttt 121  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  425473 agtccataccaagatagtagtagtagcagatcacatccaacatctatccgcaaacattactgattttattgattcttgcattgcaatgttgtcaattttt 425572  T
Q  122 taccaactttagtgttggtnnnnnnnnttatagtgatagtagtgtcatccttcatggctagcccctgtaacttttatattcttcgac 208  Q
    |||||||||||||||||||        ||||||| ||||||||||||||||||||||| ||||||||||| ||||||| | ||||||    
T  425573 taccaactttagtgttggtaaaaaaaattatagttatagtagtgtcatccttcatggcgagcccctgtaatttttatagtattcgac 425659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University