View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15896_high_33 (Length: 227)

Name: NF15896_high_33
Description: NF15896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15896_high_33
NF15896_high_33
[»] chr3 (2 HSPs)
chr3 (141-217)||(29554798-29554874)
chr3 (18-84)||(29554675-29554741)
[»] chr5 (1 HSPs)
chr5 (147-217)||(42779794-42779863)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 29554798 - 29554874
Alignment:
Q  141 ttctgttgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatctgtgctgct 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  29554798 ttctgttgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatttgtgctgct 29554874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 29554675 - 29554741
Alignment:
Q  18 aacatggtatcaaaagctttcttcgatccaccttgaactacggtttcacttccattattgagttcct 84  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  29554675 aacatggtatcaaaagctttgttcgatccaccttgaactacggtttcacttccattattgagttcct 29554741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 217
Target Start/End: Complemental strand, 42779863 - 42779794
Alignment:
Q  147 tgaagaaaatttaatctgttgcttttgttcagttagcaatatgtggtctattcttttgaatctgtgctgct 217  Q
    ||||||||||| ||| |||||||||| ||  | |||||||||||||||||||||||||||| |||||||||    
T  42779863 tgaagaaaattgaatttgttgctttttttt-gctagcaatatgtggtctattcttttgaatttgtgctgct 42779794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University